IndentationError: expected an indented blockĭoes anyone know where the indentation error is here? My. Sequences = SeqIO.parse(input_handle, "genbank")Ĭount = SeqIO.write(sequences, output_handle, "fasta")Īnd here's the error: Traceback (most recent call last):įile "/usr/lib64/python2.6/site-packages/Bio/SeqIO/_init_.py", line 362, in įile "/usr/lib64/python2.6/site-packages/Bio/SeqIO/InsdcIO.py", line 37, in įrom import GenBankScanner, EmblScanner, _ImgtScannerįile "/usr/lib64/python2.6/site-packages/Bio/GenBank/_init_.py", line 52, in įile "/usr/lib64/python2.6/site-packages/Bio/GenBank/Scanner.py", line 38ĭifferent in layout to those produced by GenBank/DDBJ.""" Here's the python code to convert: #!/usr/bin/env python ORIGIN in the above "Googled example" block links here:
GCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCĬCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGĪnd here's the first few lines of sequenced from a Googled example: ORIGINġ gatcctccat atacaacggt atctccacct caggtttaga tctcaacaac ggaaccattgĦ1 ccgacatgag acagttaggt atcgtcgaga gttacaagct aaaacgagca gtagtcagctġ21 ctgcatctga agccgctgaa gttctactaa gggtggataa catcatccgt gcaagaccaaġ81 gaaccgccaa tagacaacat atgtaacata tttaggatat acctcgaaaa taataaaccgĢ41 ccacactgtc attattataa ttagaaacag aacgcaaaaa ttatccacta tataattcaa GTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATA Here's the first few lines of sequence from the. However, as we all know, there's always something.
I figured it would be easy, using Biopython. gb files from Vector NTI that I need for convert to FASTA format.
0 kommentar(er)
